Voir le flux RSS

Messages des blogs récents

  1. Module Python pour convertir un fichier JSON en base de données SQLite

    par , 14/10/2020 à 12h05
    Objectif : Comprendre les règles de transformation d'un fichier JSON en base de données SQLite, puis savoir comment paramétrer la fonction Python permettant de créer la base de données.


    I. Introduction

    Après avoir détaillé la structure générale d'un fichier JSON (JavaScript Object Notation ), on décrira les règles de transformation du fichier en une base de données SQLite : les structures d'objets deviennent des tables et les dépendances entre objets deviennent ...
  2. Python. Traducteur de bases azotées (ARN ou ADN) en protéines.

    par , 08/06/2020 à 10h41
    Traducteur

    Code Python : Sélectionner tout - Visualiser dans une fenêtre à part
    1
    2
    3
    4
    5
    6
    7
    8
    9
    10
    11
    12
    13
    #! python3
    # coding: utf-8
     
    """ Python. Traducteur de bases azotées (ARN ou ADN) en protéines. """
     
     
    import requests
     
     
    def traducteur_basesAzotees__proteine(sequence="ATTGCCTTACAAGTATACGGGTTACTAAA"):
        """
            Traducteur de bases azotées (ARN ou ADN) en protéines 
            Dans ce programme la variable "sequence" est répliquée,
    ...
  3. Python. Exemple asynchrone pour Python 3.7+.

    par , 04/06/2020 à 11h37
    Hormis l'utilisation de l'asynchrone, ce code est assez simple, voir les commentaires dans le code.

    Code Python : Sélectionner tout - Visualiser dans une fenêtre à part
    1
    2
    3
    4
    5
    6
    7
    8
    9
    10
    11
    12
    #! python3
    # coding: utf-8
     
    """ Ce code requiert Python 3.7 ou plus """
     
    import time
    import requests_async as requests  # https://pypi.org/project/requests-async/
    from bs4 import BeautifulSoup      # https://pypi.org/project/beautifulsoup4/
    import asyncio
     
     
    async def test_1_bs4():
    ...
  4. Python. Exemple utilisant une "dataclass", une "class" et une fonction "main" asynchrone.

    par , 24/05/2020 à 20h27
    L'énoncé d'un exercice m'a donné l'envie de le réaliser en le modifiant légèrement.

    Je stocke les données d'un SMS dans une dataclass au lieu d'un tuple et j'utilise asyncio pour différer l'arrivée des SMS et parcourir avec un léger décalage les instructions du programme.

    Code Python : Sélectionner tout - Visualiser dans une fenêtre à part
    1
    2
    3
    4
    5
    6
    7
    8
    9
    #! python3
    # coding: utf-8
     
    import asyncio
    from dataclasses import dataclass
     
    # ---------------------------------
     
    from termcolor import cprint
    ...
  5. Python, shelve. Persistance des données.

    par , 21/05/2020 à 19h21
    Lorsqu'un programme a besoin de sauvegarder son état lorsqu'il s'arrête et de récupérer son état lorsqu'il démarre, on peut utiliser le module shelve qui utilise en interne le module pickle pour transformer un objet python complexe en un flux d'octets et inversement.

    Le module shelve crée des fichiers qui gèrent un dictionnaire de données. La sauvegarde et la restauration de données sont triviales. Les complications éventuelles dépendent de votre code, de la quantité de données à ...
Page 1 sur 12 1234511 ... DernièreDernière