IdentifiantMot de passe
Loading...
Mot de passe oublié ?Je m'inscris ! (gratuit)
Voir le flux RSS

Messages des blogs récents

  1. [Actualité] Filtrer une source MS SQL avec Power Query (L'histoire des trois petits cochons revisitée)

    par , 24/09/2021 à 09h43
    Salut

    Dans cet ancien billet, je montrais comment filtrer une requête Power Query sur base d'un critère exprimé côté Excel. Dans cet autre billet, j'expliquais comment Power Query "comprenait" une cellule nommée Excel. Ces techniques illustrent deux solutions pour filtrer une requête Power Query: la cellule nommée et le tableau structuré.

    Power Query propose de rechercher des données sur un serveur SQL et propose alors de choisir les tables qui seront récupérées ...

    Mis à jour 26/09/2021 à 04h28 par Malick (Centrage des images)

    Catégories
    Excel , MS Office , Power Query, Power Pivot, Power View
  2. Tableaux en VBA: LBound, UBound... Quel indice pour la première ligne de l'array? A quoi sert Option Base?

    par , 17/09/2021 à 19h44
    Salut.

    Régulièrement sur le forum, on pose la question de savoir à quel indice commence un tableau VBA (array): 1 ou 0? En fait, ça dépend de plusieurs choses

    Par défaut

    Par défaut, un array démarre à l'indice 0 => Dim tableau(5) créera donc un tableau de 6 lignes allant de 0 à 5, et l'indice i utilisé pour pointer une des cellules du tableau devra être 0 <= i <= 5. Tableau(6) plantera donc le code avec l'erreur L"indice n'appartient ...

    Mis à jour 19/09/2021 à 10h09 par Pierre Fauconnier

    Catégories
    VBA , MS Office
  3. Python. Traducteur de bases azotées (ARN ou ADN) en protéines.

    par , 08/06/2020 à 10h41
    Traducteur

    Code Python : Sélectionner tout - Visualiser dans une fenêtre à part
    1
    2
    3
    4
    5
    6
    7
    8
    9
    10
    11
    12
    13
    #! python3
    # coding: utf-8
     
    """ Python. Traducteur de bases azotées (ARN ou ADN) en protéines. """
     
     
    import requests
     
     
    def traducteur_basesAzotees__proteine(sequence="ATTGCCTTACAAGTATACGGGTTACTAAA"):
        """
            Traducteur de bases azotées (ARN ou ADN) en protéines 
            Dans ce programme la variable "sequence" est répliquée,
    ...