Tab Content
Plus de résultats

Statistiques


Messages au total
Messages au total
6 360
Messages par jour
1,52
Albums
Albums au total
1
Images au total
9
Informations générales
Dernière activité
Hier 22h26
Date d'inscription
05/02/2009
Voir le blog de danielhagnoul

Billets récents

Python. Traducteur de bases azotées (ARN ou ADN) en protéines.

par danielhagnoul, 08/06/2020 à 10h41
Traducteur

Code Python : Sélectionner tout - Visualiser dans une fenêtre à part
1
2
3
4
5
6
7
8
9
10
11
12
13
#! python3
# coding: utf-8
 
""" Python. Traducteur de bases azotées (ARN ou ADN) en protéines. """
 
 
import requests
 
 
def traducteur_basesAzotees__proteine(sequence="ATTGCCTTACAAGTATACGGGTTACTAAA"):
    """
        Traducteur de bases azotées (ARN ou ADN) en protéines 
        Dans ce programme la variable "sequence" est répliquée,

En lire plus...

Catégories
Python , Python , Programmation

Python. Exemple asynchrone pour Python 3.7+.

par danielhagnoul, 04/06/2020 à 11h37
Hormis l'utilisation de l'asynchrone, ce code est assez simple, voir les commentaires dans le code.

Code Python : Sélectionner tout - Visualiser dans une fenêtre à part
1
2
3
4
5
6
7
8
9
10
11
12
#! python3
# coding: utf-8
 
""" Ce code requiert Python 3.7 ou plus """
 
import time
import requests_async as requests  # https://pypi.org/project/requests-async/
from bs4 import BeautifulSoup      # https://pypi.org/project/beautifulsoup4/
import asyncio
 
 
async def test_1_bs4():

En lire plus...

Catégories
Python , Python , Programmation

Python. Exemple utilisant une "dataclass", une "class" et une fonction "main" asynchrone.

par danielhagnoul, 24/05/2020 à 20h27
L'énoncé d'un exercice m'a donné l'envie de le réaliser en le modifiant légèrement.

Je stocke les données d'un SMS dans une dataclass au lieu d'un tuple et j'utilise asyncio pour différer l'arrivée des SMS et parcourir avec un léger décalage les instructions du programme.

Code Python : Sélectionner tout - Visualiser dans une fenêtre à part
1
2
3
4
5
6
7
8
9
#! python3
# coding: utf-8
 
import asyncio
from dataclasses import dataclass
 
# ---------------------------------
 
from termcolor import cprint

En lire plus...

Catégories
Python , Python , Programmation

Python, shelve. Persistance des données.

par danielhagnoul, 21/05/2020 à 19h21
Lorsqu'un programme a besoin de sauvegarder son état lorsqu'il s'arrête et de récupérer son état lorsqu'il démarre, on peut utiliser le module shelve qui utilise en interne le module pickle pour transformer un objet python complexe en un flux d'octets et inversement.

Le module shelve crée des fichiers qui gèrent un dictionnaire de données. La sauvegarde et la restauration de données sont triviales. Les complications éventuelles dépendent de votre code, de la quantité de données à

En lire plus...

Catégories
Python , Python , Programmation

Python. Parcours préfixe, infixe et postfixe d'un arbre binaire contenu dans un dictionnaire.

par danielhagnoul, 17/05/2020 à 22h30
Code Python : Sélectionner tout - Visualiser dans une fenêtre à part
1
2
3
4
5
6
7
8
9
10
11
12
#! python3
# coding: utf-8
 
binary_tree = {'r': ['a', 'b'], 'a': ['c', 'd'], 'b': ['e', 'f'],
               'c': ['', 'h'], 'd': ['i', 'j'], 'e': ['k', ''], 'f': ['', ''],
               'h': ['', ''], 'i': ['', ''], 'j': ['m', ''], 'k': ['', ''], 'm': ['', '']}
 
 
def binary_tree_parcours_prefixe(root_str, T):
    """ Parcours prefixe de l'arbre binaire T """
    parcours = []
    key = root_str

En lire plus...

Mis à jour 24/05/2020 à 20h28 par danielhagnoul

Catégories
Python , Python , Programmation
Aucune certification n'a été indiquée. Déclarez vos certifications