CLUSTAL W (1.83) Multiple Sequence Alignments
Sequence format is Pearson
Sequence 1: GB 1014 bp
Sequence 2: MySQL 1014 bp
Sequence 3: Split 1014 bp
Start of Pairwise alignments
Aligning...
Sequences (1:2) Aligned. Score: 2
Sequences (1:3) Aligned. Score: 2
Sequences (2:3) Aligned. Score: 99
Guide tree file created: [D:\DOCUME~1\xxx\LOCALS~1\Temp\LodXwLx5m1\K4w4zDLoNl.dnd]
Start of Multiple Alignment
There are 2 groups
Aligning...
Group 1: Sequences: 2 Score:19247
Group 2: Delayed
Sequence:1 Score:9364
Alignment Score 12337
GCG-Alignment file created [d:\docume~1\xxxx\locals~1\temp\lodxwlx5m1\4h3nwligdx]
Longueur 1049
Nbr de résidus 105
Flush 1
Nbr de séquences 3
Pourcentage d'identité 61.4064602960969
Consensus ?TACCTCTCACTAGTGAGGGGCGGCAGCGCATCAA?GCGGTGAGCGCACTCCGGCACCGCC???AACTTTCAGCACATGCGTGTAAATCA?TCGTCGTAGAGACGTCGGAATGGCCGAGCAGAT?CCTGCACGGTTCGA
Partager