Publicité
+ Répondre à la discussion
Affichage des résultats 1 à 8 sur 8
  1. #1
    Expert Confirmé Sénior
    Avatar de Jedai
    Homme Profil pro
    Enseignant
    Inscrit en
    avril 2003
    Messages
    6 173
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France, Côte d'Or (Bourgogne)

    Informations professionnelles :
    Activité : Enseignant

    Informations forums :
    Inscription : avril 2003
    Messages : 6 173
    Points : 8 308
    Points
    8 308

    Par défaut Petit recueil sources et uniligne pour la Bioinformatique

    http://sysbio.harvard.edu/csb/resour...nal/scriptome/

    A cette adresse vous trouverez des tas d'unilignes avec une interface qui permet de trouver le bon, de sorte que vous n'avez plus qu'à copier-coller sur la ligne de commande.

    --
    Jedaï

  2. #2
    Responsable Perl et Outils

    Avatar de djibril
    Homme Profil pro
    Inscrit en
    avril 2004
    Messages
    16 744
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France

    Informations forums :
    Inscription : avril 2004
    Messages : 16 744
    Points : 490 680
    Points
    490 680

    Par défaut

    Il serait intéressant que l'on crée une section bioinformatique dans les sources de notre rubrique Perl. Mais pour cela, il faudrait que chacun de vous puisse nous donner une petite liste de Questions / Réponses. Cela permettrait d'avoir un recueil de petits codes utilisables par tout le monde et bien centralisé comme c'est déjà le cas pour les autres codes.

    J'attends donc que vous puissiez participer à l'élaboration des questions et réponses (non obligatoire si vous n'avez pas la réponse).

    Merci par avance de votre participation.

    N.B. Il faut que votre Q/R contienne
    1. un titre : c'est la question posée ;
    2. votre code bien indenté et commenté (pensez aux lecteurs) ;
    3. un petit paragraphe d'explication ;
    4. si vous utilisez un module, merci de me donner le lien pointant vers ce module ;
    5. merci de donner un exemple de fichier d'entrée et/ou sortie si le code en utilise ;
    6. et un exemple de résultat en adéquation avec votre code et vos fichiers.


    Tout cela permet aux utilisateurs de voir tout de suite le rendu de votre code et de pouvoir le tester en un simple copier/coller.

    Pas de questions technique par messagerie privée (lisez les règles du forum Perl) et pour les nouveaux !

  3. #3
    Membre Expert
    Avatar de Jasmine80
    Femme Profil pro Jasmine
    Bioinformaticienne
    Inscrit en
    octobre 2006
    Messages
    2 947
    Détails du profil
    Informations personnelles :
    Nom : Femme Jasmine
    Âge : 34
    Localisation : France, Haute Savoie (Rhône Alpes)

    Informations professionnelles :
    Activité : Bioinformaticienne
    Secteur : Santé

    Informations forums :
    Inscription : octobre 2006
    Messages : 2 947
    Points : 2 438
    Points
    2 438

    Par défaut

    QUESTION : comment récupérer (proprement) les séquences d'un fichier fasta?

    REPONSE : avec le module Bio::SeqIO

    BUT : récupérer les identifiants et leur séquence une à une de façon simple et rapide

    Code :
    1
    2
    3
    4
    5
    6
    7
    8
    9
    10
    11
    12
    13
    14
    15
    16
    17
    18
    19
    20
    21
    #!/usr/bin/perl
     
    use strict;
    use warnings;
    use Bio::SeqIO;
     
     
    # fichier d'entrée
    my $in  = Bio::SeqIO->new(-file => "test.txt", '-format' => 'Fasta');
     
    # fichier de sortie
    my $out = Bio::SeqIO->new(-file => ">exit.fas", '-format' => 'Fasta');
     
    # récupération des séquences
    while ( my $seq = $in->next_seq()){
        my $id = $seq->primary_id ;
        my $sequence = $seq->seq ;
     
        # écriture dans le fichier de sortie
        $out ->write_seq($seq);
    }
    -- Jasmine --

    Merci de poser les questions dans le forum, je ne répondrai pas aux MP.

  4. #4
    Membre Expert
    Avatar de Jasmine80
    Femme Profil pro Jasmine
    Bioinformaticienne
    Inscrit en
    octobre 2006
    Messages
    2 947
    Détails du profil
    Informations personnelles :
    Nom : Femme Jasmine
    Âge : 34
    Localisation : France, Haute Savoie (Rhône Alpes)

    Informations professionnelles :
    Activité : Bioinformaticienne
    Secteur : Santé

    Informations forums :
    Inscription : octobre 2006
    Messages : 2 947
    Points : 2 438
    Points
    2 438

    Par défaut

    QUESTION : est-il possible de récupérer des sous-séquences d'un alignement

    REPONSE : oui, avec le module :Bio::AlignIO

    BUT : permettre de récupérer et d'analyser les séquences une à une en gardant les positions des gaps, on peut donc aussi récupérer un bloc de sous-séquences en gardant leur alignement, mais également obtenir la séquence consensuelle de cet alignement.


    Code :
    1
    2
    3
    4
    5
    6
    7
    8
    9
    10
    11
    12
    13
    14
    15
    16
    17
    18
    19
    20
    21
    22
    23
    24
    25
    26
    27
    use strict;
    use warnings;
     
    use Bio::AlignIO;
     
     
     
     
    # fichier d'entrée
    my $inputfilename = "file.fsa";
    my $in  = Bio::AlignIO->new(-file => $inputfilename ,
    		     '-format' => 'fasta');
     
    my $aln = $in->next_aln();
     
    # recherche de la séquence consensus à 50%
    print $aln->consensus_string(50);
     
     
     
    # manipulation de séquences alignées
    foreach my $seq ($aln->each_seq) {
     
    	# récupération de sous-séquences
    	my $res = $seq->subseq(1121,1163);		
     
    }
    -- Jasmine --

    Merci de poser les questions dans le forum, je ne répondrai pas aux MP.

  5. #5
    Responsable Perl et Outils

    Avatar de djibril
    Homme Profil pro
    Inscrit en
    avril 2004
    Messages
    16 744
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France

    Informations forums :
    Inscription : avril 2004
    Messages : 16 744
    Points : 490 680
    Points
    490 680

    Par défaut

    Super jasmine . Peux-tu compléter tes programmes de tous petits fichiers d'exemples. ça me permettra de mettre ton code avec un exemple de fichier fasta et d'alignement. Les gens pourront de ce fait faire un vrai test de tes programmes.

    Pas de questions technique par messagerie privée (lisez les règles du forum Perl) et pour les nouveaux !

  6. #6
    Membre Expert
    Avatar de Jasmine80
    Femme Profil pro Jasmine
    Bioinformaticienne
    Inscrit en
    octobre 2006
    Messages
    2 947
    Détails du profil
    Informations personnelles :
    Nom : Femme Jasmine
    Âge : 34
    Localisation : France, Haute Savoie (Rhône Alpes)

    Informations professionnelles :
    Activité : Bioinformaticienne
    Secteur : Santé

    Informations forums :
    Inscription : octobre 2006
    Messages : 2 947
    Points : 2 438
    Points
    2 438

    Par défaut

    séquences

    >A1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCAGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT



    séquences alignées
    >A1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >A2/1-57
    ..TACCAGCGGGATCATTATGC.ACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B1/1-55
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTG....ATAGATCTGACT.
    .
    >C1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >C2/1-60
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B2/1-61
    GATACCAGCCGGATCATTATGCCACATTCTGATCGTGGACCTGCATTATAGATCTGCCCT
    T
    -- Jasmine --

    Merci de poser les questions dans le forum, je ne répondrai pas aux MP.

  7. #7
    Responsable Perl et Outils

    Avatar de djibril
    Homme Profil pro
    Inscrit en
    avril 2004
    Messages
    16 744
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France

    Informations forums :
    Inscription : avril 2004
    Messages : 16 744
    Points : 490 680
    Points
    490 680

    Par défaut

    Citation Envoyé par Jasmine80 Voir le message
    QUESTION : comment récupérer (proprement) les séquences d'un fichier fasta?

    REPONSE : avec le module Bio::SeqIO

    BUT : récupérer les identifiants et leur séquence une à une de façon simple et rapide

    Code :
    1
    2
    3
    4
    5
    6
    7
    8
    9
    10
    11
    12
    13
    14
    15
    16
    17
    18
    19
    20
    21
    #!/usr/bin/perl
     
    use strict;
    use warnings;
    use Bio::SeqIO;
     
     
    # fichier d'entrée
    my $in  = Bio::SeqIO->new(-file => "test.txt", '-format' => 'Fasta');
     
    # fichier de sortie
    my $out = Bio::SeqIO->new(-file => ">exit.fas", '-format' => 'Fasta');
     
    # récupération des séquences
    while ( my $seq = $in->next_seq()){
        my $id = $seq->primary_id ;
        my $sequence = $seq->seq ;
     
        # écriture dans le fichier de sortie
        $out ->write_seq($seq);
    }
    Il faudrait peut être préciser que Bioperl charge tout le fichier en mémoire, donc en cas de fichiers très très gros, cela peut poser un souci.

    Pas de questions technique par messagerie privée (lisez les règles du forum Perl) et pour les nouveaux !

  8. #8
    Responsable Perl et Outils

    Avatar de djibril
    Homme Profil pro
    Inscrit en
    avril 2004
    Messages
    16 744
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France

    Informations forums :
    Inscription : avril 2004
    Messages : 16 744
    Points : 490 680
    Points
    490 680

    Par défaut

    La section Bioinformatique est maintenant disponible dans nos sources, à vos claviers pour nous aider à l'alimenter.

    Merci Jasmine80 pour tes premières questions/réponses .

    Pas de questions technique par messagerie privée (lisez les règles du forum Perl) et pour les nouveaux !

Liens sociaux

Règles de messages

  • Vous ne pouvez pas créer de nouvelles discussions
  • Vous ne pouvez pas envoyer des réponses
  • Vous ne pouvez pas envoyer des pièces jointes
  • Vous ne pouvez pas modifier vos messages
  •