OO méthode multiple_digest de Bio::Restriction::Analysis

Bio::Restriction::Analysis

Citation:

---

mulitple_digest

Title : multiple_digest
Function : perform a multiple digest on a sequence
Returns : $self so you can go and get any of the other methods
Arguments : An enzyme collection

Multiple digests can use 1 or more enzymes, and the data is stored
in as if it were an enzyme called multiple_digest. You can then
retrieve information about multiple digests from any of the other
methods.

You can use this method in place of $re->cut('multiple', $enz_coll);

---

Bio::Restriction::EnzymeCollection

Citation:

---

# Get a Bio::Restriction::Enzyme object for a particular enzyme by name.
my $enz = $default_collection->get_enzyme( 'EcoRI' );

---

Code:

---

1 2 3 4 5 6 7 8

my @enz_obj;   foreach my $enz_name ('Alu', 'EcoR1'){   # Get a Bio::Restriction::Enzyme object for a particular enzyme by name. push @enz_obj, $default_collection->get_enzyme( $enz_name );   }

---

Si ensuite j'ajoute

Code:

---

my $self = $ra->cut('multiple', @enz_obj);

---

ou

Code:

---

my $self = $ra->cut('multiple', $default_collection->get_enzyme('Alu') );

---

j'ai l'erreur :

Citation:

---

------------- EXCEPTION -------------
MSG: You must supply a separate enzyme collection for multiple digests
STACK Bio::Restriction::Analysis::cut C:/Perl/site/lib/Bio/Restriction/Analysis.pm:356
STACK toplevel Restriction_analysis.pl:71

--------------------------------------

---

Avec

Code:

---

my $self = $ra->mulitple_digest(@enz_obj);

---

c'est

Citation:

---

Can't locate object method "mulitple_digest" via package "Bio::Restriction::Analysis" at Restriction_analysis.pl line 71, <DATA> line 1064.

---

J'ai essayé ces méthodes avec des références d'array mais ça ne fonctionne pas non plus. Avez-vous une idée? Quel doit être l'argument quand on veut utiliser plusieurs enzymes?

Voici un code qui peut directement être testé

Code:

---

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34

#!/usr/bin/perl -w   use strict;   use Bio::Restriction::Analysis;       # liste des enzymes diponibles my $default_collection = Bio::Restriction::EnzymeCollection->new();     # get a DNA sequence from somewhere my $seq = Bio::PrimarySeq->new (-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTC', -primary_id => 'synopsis', -molecule => 'dna');     # now start an analysis. # this is using the default set of enzymes my $ra = Bio::Restriction::Analysis->new(-seq=>$seq, -is_circular => 1);     my @enz_obj;   foreach my $enz_name ('Alu', 'EcoR1'){   # Get a Bio::Restriction::Enzyme object for a particular enzyme by name. push @enz_obj, $default_collection->get_enzyme( $enz_name );   }   my $self = $ra->mulitple_digest(@enz_obj);

---

Merci pour votre aide;

J'arrive à ne plus avoir d'erreur en utilisant la méthode cutters au lieu de get_enzyme

Code:

---

1 2 3 4 5 6 7 8 9 10 11

foreach my $enz_name ('Alu', 'EcoR1'){     # Get a Bio::Restriction::EnzymeCollection object containing the enzymes # that have the equivalent of 6-bp recognition sequences. my $six_cutters = $default_collection->cutters( 6 );     my $self = $ra->cut('multiple', $six_cutters);   }

---

J'aimerais obtenir le même résultat mais en utilisant le nom de l'enzyme comme argument.


Que signifie

Citation:

---

Returns : $self so you can go and get any of the other methods

---

On peut utiliser sur $self toutes les autres méthodes de quoi?

Voila, j'ai trouvé :

Code:

---

1 2 3 4 5 6 7 8 9 10

# See 'CUSTOM COLLECTIONS' below for an example of creating a # Bio::Restriction::EnzymeCollection object with a specified subset of # enzymes using methods provided by the Bio::RestrictionEnzyme class.   my $complete_collection = Bio::Restriction::EnzymeCollection->new(); my $type_ii_collection = Bio::Restriction::EnzymeCollection->new( -empty => 1 ); $type_ii_collection->enzymes( grep { $_->type() eq 'II' } $complete_collection->each_enzyme() );

---

Voila ce que je voulais :

Code:

---

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

my $new_collection = Bio::Restriction::EnzymeCollection->new( -empty => 1 );     foreach my $enz_name ('EcoR1', 'AluI' ){ $new_collection->enzymes( grep { $_->name() eq $enz_name } $default_collection->each_enzyme() ); }   # Bio::Restriction::Analysis my $self = $ra->cut('multiple', $new_collection);     my @frags = $self->fragments;   print "fragment lengths: ", join(' & ', map {length $_} @frags), "\n";

---

... mais cela semble impossible à obtenir :

Citation:

---

If passes an enzyme collection it will return the result of a multiple digest. This : will also cause the special enzyme 'multiple_digest' to be created so you can get : other information about this multiple digest. (TMTOWTDI).

There is a minor problem with this and $self->fragments that I haven't got a good answer for (at the moment). If the sequence is not cut, do we return undef, or the whole sequence?

For linear fragments it would be good to return the whole sequence. For circular fragments I am not sure.

At the moment it returns the whole sequence with start of 1 and end of length of the sequence. For example:

---