p
u
b
l
i
c
i
t
é
publicité
  1. #1
    Expert Confirmé Sénior
    Avatar de Jedai
    Homme Profil pro
    Enseignant
    Inscrit en
    avril 2003
    Messages
    6 215
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France, Côte d'Or (Bourgogne)

    Informations professionnelles :
    Activité : Enseignant

    Informations forums :
    Inscription : avril 2003
    Messages : 6 215
    Points : 8 404
    Points
    8 404

    Par défaut Petit recueil sources et uniligne pour la Bioinformatique

    http://sysbio.harvard.edu/csb/resour...nal/scriptome/

    A cette adresse vous trouverez des tas d'unilignes avec une interface qui permet de trouver le bon, de sorte que vous n'avez plus qu'à copier-coller sur la ligne de commande.

    --
    Jedaï

  2. #2
    Responsable Perl et Outils

    Avatar de djibril
    Homme Profil pro
    Inscrit en
    avril 2004
    Messages
    17 690
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France

    Informations forums :
    Inscription : avril 2004
    Messages : 17 690
    Points : 492 624
    Points
    492 624

    Par défaut

    Il serait intéressant que l'on crée une section bioinformatique dans les sources de notre rubrique Perl. Mais pour cela, il faudrait que chacun de vous puisse nous donner une petite liste de Questions / Réponses. Cela permettrait d'avoir un recueil de petits codes utilisables par tout le monde et bien centralisé comme c'est déjà le cas pour les autres codes.

    J'attends donc que vous puissiez participer à l'élaboration des questions et réponses (non obligatoire si vous n'avez pas la réponse).

    Merci par avance de votre participation.

    N.B. Il faut que votre Q/R contienne
    1. un titre : c'est la question posée ;
    2. votre code bien indenté et commenté (pensez aux lecteurs) ;
    3. un petit paragraphe d'explication ;
    4. si vous utilisez un module, merci de me donner le lien pointant vers ce module ;
    5. merci de donner un exemple de fichier d'entrée et/ou sortie si le code en utilise ;
    6. et un exemple de résultat en adéquation avec votre code et vos fichiers.


    Tout cela permet aux utilisateurs de voir tout de suite le rendu de votre code et de pouvoir le tester en un simple copier/coller.

    Pas de questions technique par messagerie privée (lisez les règles du forum Perl) et pour les nouveaux !

  3. #3
    Expert Confirmé
    Avatar de Jasmine80
    Femme Profil pro
    Bioinformaticienne
    Inscrit en
    octobre 2006
    Messages
    3 042
    Détails du profil
    Informations personnelles :
    Sexe : Femme
    Âge : 35
    Localisation : Royaume-Uni

    Informations professionnelles :
    Activité : Bioinformaticienne
    Secteur : Santé

    Informations forums :
    Inscription : octobre 2006
    Messages : 3 042
    Points : 2 549
    Points
    2 549

    Par défaut

    QUESTION : comment récupérer (proprement) les séquences d'un fichier fasta?

    REPONSE : avec le module Bio::SeqIO

    BUT : récupérer les identifiants et leur séquence une à une de façon simple et rapide

    Code : Sélectionner tout - Visualiser dans une fenêtre à part
    1
    2
    3
    4
    5
    6
    7
    8
    9
    10
    11
    12
    13
    14
    15
    16
    17
    18
    19
    20
    21
    #!/usr/bin/perl
     
    use strict;
    use warnings;
    use Bio::SeqIO;
     
     
    # fichier d'entrée
    my $in  = Bio::SeqIO->new(-file => "test.txt", '-format' => 'Fasta');
     
    # fichier de sortie
    my $out = Bio::SeqIO->new(-file => ">exit.fas", '-format' => 'Fasta');
     
    # récupération des séquences
    while ( my $seq = $in->next_seq()){
        my $id = $seq->primary_id ;
        my $sequence = $seq->seq ;
     
        # écriture dans le fichier de sortie
        $out ->write_seq($seq);
    }
    -- Jasmine --

  4. #4
    Expert Confirmé
    Avatar de Jasmine80
    Femme Profil pro
    Bioinformaticienne
    Inscrit en
    octobre 2006
    Messages
    3 042
    Détails du profil
    Informations personnelles :
    Sexe : Femme
    Âge : 35
    Localisation : Royaume-Uni

    Informations professionnelles :
    Activité : Bioinformaticienne
    Secteur : Santé

    Informations forums :
    Inscription : octobre 2006
    Messages : 3 042
    Points : 2 549
    Points
    2 549

    Par défaut

    QUESTION : est-il possible de récupérer des sous-séquences d'un alignement

    REPONSE : oui, avec le module :Bio::AlignIO

    BUT : permettre de récupérer et d'analyser les séquences une à une en gardant les positions des gaps, on peut donc aussi récupérer un bloc de sous-séquences en gardant leur alignement, mais également obtenir la séquence consensuelle de cet alignement.


    Code : Sélectionner tout - Visualiser dans une fenêtre à part
    1
    2
    3
    4
    5
    6
    7
    8
    9
    10
    11
    12
    13
    14
    15
    16
    17
    18
    19
    20
    21
    22
    23
    24
    25
    26
    27
    use strict;
    use warnings;
     
    use Bio::AlignIO;
     
     
     
     
    # fichier d'entrée
    my $inputfilename = "file.fsa";
    my $in  = Bio::AlignIO->new(-file => $inputfilename ,
    		     '-format' => 'fasta');
     
    my $aln = $in->next_aln();
     
    # recherche de la séquence consensus à 50%
    print $aln->consensus_string(50);
     
     
     
    # manipulation de séquences alignées
    foreach my $seq ($aln->each_seq) {
     
    	# récupération de sous-séquences
    	my $res = $seq->subseq(1121,1163);		
     
    }
    -- Jasmine --

  5. #5
    Responsable Perl et Outils

    Avatar de djibril
    Homme Profil pro
    Inscrit en
    avril 2004
    Messages
    17 690
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France

    Informations forums :
    Inscription : avril 2004
    Messages : 17 690
    Points : 492 624
    Points
    492 624

    Par défaut

    Super jasmine . Peux-tu compléter tes programmes de tous petits fichiers d'exemples. ça me permettra de mettre ton code avec un exemple de fichier fasta et d'alignement. Les gens pourront de ce fait faire un vrai test de tes programmes.

    Pas de questions technique par messagerie privée (lisez les règles du forum Perl) et pour les nouveaux !

  6. #6
    Expert Confirmé
    Avatar de Jasmine80
    Femme Profil pro
    Bioinformaticienne
    Inscrit en
    octobre 2006
    Messages
    3 042
    Détails du profil
    Informations personnelles :
    Sexe : Femme
    Âge : 35
    Localisation : Royaume-Uni

    Informations professionnelles :
    Activité : Bioinformaticienne
    Secteur : Santé

    Informations forums :
    Inscription : octobre 2006
    Messages : 3 042
    Points : 2 549
    Points
    2 549

    Par défaut

    séquences

    >A1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCAGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT



    séquences alignées
    >A1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >A2/1-57
    ..TACCAGCGGGATCATTATGC.ACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B1/1-55
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTG....ATAGATCTGACT.
    .
    >C1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >C2/1-60
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B2/1-61
    GATACCAGCCGGATCATTATGCCACATTCTGATCGTGGACCTGCATTATAGATCTGCCCT
    T
    -- Jasmine --

  7. #7
    Responsable Perl et Outils

    Avatar de djibril
    Homme Profil pro
    Inscrit en
    avril 2004
    Messages
    17 690
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France

    Informations forums :
    Inscription : avril 2004
    Messages : 17 690
    Points : 492 624
    Points
    492 624

    Par défaut

    Citation Envoyé par Jasmine80 Voir le message
    QUESTION : comment récupérer (proprement) les séquences d'un fichier fasta?

    REPONSE : avec le module Bio::SeqIO

    BUT : récupérer les identifiants et leur séquence une à une de façon simple et rapide

    Code : Sélectionner tout - Visualiser dans une fenêtre à part
    1
    2
    3
    4
    5
    6
    7
    8
    9
    10
    11
    12
    13
    14
    15
    16
    17
    18
    19
    20
    21
    #!/usr/bin/perl
     
    use strict;
    use warnings;
    use Bio::SeqIO;
     
     
    # fichier d'entrée
    my $in  = Bio::SeqIO->new(-file => "test.txt", '-format' => 'Fasta');
     
    # fichier de sortie
    my $out = Bio::SeqIO->new(-file => ">exit.fas", '-format' => 'Fasta');
     
    # récupération des séquences
    while ( my $seq = $in->next_seq()){
        my $id = $seq->primary_id ;
        my $sequence = $seq->seq ;
     
        # écriture dans le fichier de sortie
        $out ->write_seq($seq);
    }
    Il faudrait peut être préciser que Bioperl charge tout le fichier en mémoire, donc en cas de fichiers très très gros, cela peut poser un souci.

    Pas de questions technique par messagerie privée (lisez les règles du forum Perl) et pour les nouveaux !

  8. #8
    Responsable Perl et Outils

    Avatar de djibril
    Homme Profil pro
    Inscrit en
    avril 2004
    Messages
    17 690
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France

    Informations forums :
    Inscription : avril 2004
    Messages : 17 690
    Points : 492 624
    Points
    492 624

    Par défaut

    La section Bioinformatique est maintenant disponible dans nos sources, à vos claviers pour nous aider à l'alimenter.

    Merci Jasmine80 pour tes premières questions/réponses .

    Pas de questions technique par messagerie privée (lisez les règles du forum Perl) et pour les nouveaux !

Discussions similaires

  1. Ou trouver une source liste debian pour postgresql-8.x
    Par gballou dans le forum PostgreSQL
    Réponses: 3
    Dernier message: 31/07/2006, 12h29
  2. Solution de reporting Open Source en Java pour générer des rapports Word, RTF ?
    Par jmax_ dans le forum Autres outils décisionnels
    Réponses: 3
    Dernier message: 19/06/2006, 09h53
  3. Réponses: 2
    Dernier message: 24/05/2005, 16h35
  4. Je Recherche des sources Turbo pascal pour piloter en TCP/IP
    Par mennix dans le forum Turbo Pascal
    Réponses: 18
    Dernier message: 23/08/2004, 00h31
  5. [EJB2] Sources de données pour EJB
    Par thomy dans le forum Java EE
    Réponses: 4
    Dernier message: 04/06/2003, 15h52

Partager

Partager
  • Envoyer la discussion sur Viadeo
  • Envoyer la discussion sur Twitter
  • Envoyer la discussion sur Google
  • Envoyer la discussion sur Facebook
  • Envoyer la discussion sur Digg
  • Envoyer la discussion sur Delicious
  • Envoyer la discussion sur MySpace
  • Envoyer la discussion sur Yahoo