p
u
b
l
i
c
i
t
é
publicité

Discussion: aidez moi SVP

  1. #1

    Femme Profil pro
    Étudiant
    Inscrit en
    février 2013
    Messages
    3
    Détails du profil
    Informations personnelles :
    Sexe : Femme

    Informations professionnelles :
    Activité : Étudiant
    Secteur : Santé

    Informations forums :
    Inscription : février 2013
    Messages : 3
    Points : -1
    Points
    -1

    Par défaut aidez moi SVP

    Bonjour ts le monde,
    j'ai une sequence inconnue, et jai un exercice à faire dont il faut trouve l'origine de celle ci et aussi sa carte ( en réalité jai 2 sequences), aprés il faut trouver l'Orf et sa carte????
    ts cela il faut l'appliquer en NCBI.
    je veux bien que vous m'aidez, pour savoir les etapes necessaires.
    bon voila les 2 sequences
    1.
    CTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGA CCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCG CCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGAT TTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTG GGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATA GTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATT TATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAAT TTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCG CAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGG GGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTG TAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGG GCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGG ATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGT GAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTT ATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTG CCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGG GAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGC GTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGC GGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATA ACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCG CGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCT CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA GCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTC TCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGT AGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCG CCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGG CAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCT TGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGC TGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCG CTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTC AAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTT AAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTCGACCGAA TAAATACCTGTGACGGAAGATCACTTCGCAGAATAAATAAATCCTGGTGTCCCTGTTGAT ACCGGGAAGCCCTGGGCCAACTTTTGGCGAAAATGAGACGTTGATCGGCACGTAAGAGGT TCCAACTTTCACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTGTCGAGA TTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGAT ATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACC TATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAG CACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAA TTACGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTAC ACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGAT TTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCC TATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGT TTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACC ATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCAT CATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGC GATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCT GGTTGCTACGCCTGAATAAGTGATAATAAGCGGATGAATGGCAGAAATTCGAAAGCAAAT TCGACCCGGTCGTCGGTTCAGGGCAGGGTCGTTAAATAGCCGCTTATGTCTATTGCTGGT TTACCGGTTTATTGACTACCGGAAGCAGTGTGACCGTGTGCTTCTCAAATGCCTGAGGCC AGTTTGCTCAGGCTCTCCCCGTGGAGGTAATAATTGACGATATGATCCTTTTTTTCTGAT CAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGC TGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTA CTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAA TAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCA TTTATCAAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAA CAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCAC

    et puis la 2

    GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCTTCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGGCTTTTTGGCCTCTGTCGTTTCCTTTCTCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCAACAAAAAGCAGCTGGCTGACATTTTCGGTGCGAGTATCCGTACCATTCAGAACTGGCAGGAACAGGGAATGCCCGTTCTGCGAGGCGGTGGCAAGGGTAATGAGGTGCTTTATGACTCTGCCGCCGTCATAAAATGGTATGCCGAAAGGGATGCTGAAATTGAGAACGAAAAGCTGCGCCGGGAGGTTGAAGAACTGCGGCAGGCCAGCGAGGCAGATCTCCAGCCAGGAACTATTGAGTACGAACGCCATCGACTTACGCGTGCGCAGGCCGACGCACAGGAACTGAAGAATGCCAGAGACTCCGCTGAAGTGGTGGAAACCGCATTCTGTACTTTCGTGCTGTCGCGGATCGCAGGTGAAATTGCCAGTATTCTCGACGGGCTCCCCCTGTCGGTGCAGCGGCGTTTTCCGGAACTGGAAAACCGACATGTTGATTTCCTGAAACGGGATATCATCAAAGCCATGAACAAAGCAGCCGCGCTGGATGAACTGATACCGGGGTTGCTGAGTGAATATATCGAACAGTCAGGTTAACAGGCTGCGGCATTTTGTCCGCGCCGGGCTTCGCTCACTGTTCAGGCCGGAGCCACAGACCGCCGTTGAATGGGCGGATGCTAATTACTATCTCCCGAAAGAATCCGCATACCAGGAAGGGCGCTGGGAAACACTGCCCTTTCAGCGGGCCATCATGAATGCGATGGGCAGCGACTACATCCGTGAGGTGAATGTGGTGAAGTCTGCCCGTGTCGGTTATTCCAAAATGCTGCTGGGTGTTTATGCCTACTTTATAGAGCATAAGCAGCGCAACACCCTTATCTGGTTGCCGACGGATGGTGATGCCGAGAACTTTATGAAAACCCACGTTGAGCCGACTATTCGTGATATTCCGTCGCTGCTGGCGCTGGCCCCGTGGTATGGCAAAAAGCACCGGGATAACACGCTCACCATGAAGCGTTTCACTAATGGGCGTGGCTTCTGGTGCCTGGGCGGTAAAGCGGCAAAAAACTACCGTGAAAAGTCGGTGGATGTGGCGGGTTATGATGAACTTGCTGCTTTTGATGATGATATTGAACAGGAAGGCTCTCCGACGTTCCTGGGTGACAAGCGTATTGAAGGCTCGGTCTGGCCAAAGTCCATCCGTGGCTCCACGCCAAAAGTGAGAGGCACCTGTCAGATTGAGCGTGCAGCCAGTGAATCCCCGCATTTTATGCGTTTTCATGTTGCCTGCCCGCATTGCGGGGAGGAGCAGTATCTTAAATTTGGCGACAAAGAGACGCCGTTTGGCCTCAAATGGACGCCGGATGACCCCTCCAGCGTGTTTTATCTCTGCGAGCATAATGCCTGCGTCATCCGCCAGCAGGAGCTGGACTTTACTGATGCCCGTTATATCTGCGAAAAGACCGGGATCTGGACCCGTGATGGCATTCTCTGGTTTTCGTCATCCGGTGAAGAGATTGAGCCACCTGACAGTGTGACCTTTCACATCTGGACAGCGTACAGCCCGTTCACCACCTGGGTGCAGATTGTCAAAGACTGGATGAAAACGAAAGGGGATACGGGAAAACGTAAAACCTTCGTAAACACCACGCTCGGTGAGACGTGGGAGGCGAAAATTGGCGAACGTCCGGATGCTGAAGTGATGGCAGAGCGGAAAGAGCATTATTCAGCGCCCGTTCCTGACCGTGTGGCTTACCTGACCGCCGGTATCGACTCCCAGCTGGACCGCTACGAAATGCGCGTATGGGGATGGGGGCCGGGTGAGGAAAGCTGGCTGATTGACCGGCAGATTATTATGGGCCGCCACGACGATGAACAGACGCTGCTGCGTGTGGATGAGGCCATCAATAAAACCTATACCCGCCGGAATGGTGCAGAAATGTCGATATCCCGTATCTGCTGGGATACTGGCGGGATTGACCCGACCATTGTGTATGAACGCTCGAAAAAACATGGGCTGTTCCGGGTGATCCCCATTAAAGGGGCATCCGTCTACGGAAAGCCGGTGGCCAGCATGCCACGTAAGCGAAACAAAAACGGGGTTTACCTTACCGAAATCGGTACGGATACCGCGAAAGAGCAGATTTATAACCGCTTCACACTGACGCCGGAAGGGGATGAACCGCTTCCCGGTGCCGTTCACTTCCCGAATAACCCGGATATTTTTGATCTGACCGAAGCGCAGCAGCTGACTGCTGAAGAGCAGGTCGAAAAATGGGTGGATGGCAGGAAAAAAATACTGTGGGACAGCAAAAAGCGACGCAATGAGGCACTCGACTGCTTCGTTTATGCGCTGGCGGCGCTGCGCATCAGTATTTCCCGCTGGCAGCTGGATCTCAGTGCGCTGCTGGCGAGCCTGCAGGAAGAGGATGGTGCAGCAACCAACAAGAAAACACTGGCAGATTACGCCCGTGCCTTATCCGGAGAGGATGAATGACGCGACAGGAAGAACTTGCCGCTGCCCGTGCGGCACTGCATGACCTGATGACAGGTAAACGGGTGGCAACAGTACAGAAAGACGGACGAAGGGTGGAGTTTACGGCCACTTCCGTGTCTGACCTGAAAAAATATATTGCAGAGCTGGAAGTGCAGACCGGCATGACACAGCGACGCAGGGGACCTGCAGGATTTTATGTATGAAAACGCCCACCATTCCCACCCTTCTGGGGCCGGACGGCATGACATCGCTGCGCGAATATGCCGGTTATCACGGCGGTGGCAGCGGATTTGGAGGGCAGTTGCGGTCGTGGAACCCACCGAGTGAAAGTGTGGATGCAGCCCTGTTGCCCAACTTTACCCGTGGCAATGCCCGCGCAGACGATCTGGTACGCAATAACGGCTATGCCGCCAACGCCATCCAGCTGCATCAGGATCATATCGTCGGGTCTTTTTTCCGGCTCAGTCATCGCCCAAGCTGGCGCTATCTGGGCATCGGGGAGGAAGAAGCCCGTGCCTTTTCCCGCGAGGTTGAAGCGGCATGGAAAGAGTTTGCCGAGGATGACTGCTGCTGCATTGACGTTGAGCGAAAACGCACGTTTACCATGATGATTCGGGAAGGTGTGGCCATGCACGCCTTTAACGGTGAACTGTTCGTTCAGGCCACCTGGGATACCAGTTCGTCGCGGCTTTTCCGGACACAGTTCCGGATGGTCAGCCCGAAGCGCATCAGCAACCCGAACAATACCGGCGACAGCCGGAACTGCCGTGCCGGTGTGCAGATTAATGACAGCGGTGCGGCGCTGGGATATTACGTCAGCGAGGACGGGTATCCTGGCTGGATGCCGCAGAAATGGACATGGATACCCCGTGAGTTACCCGGCGGGCGCGCCTCGTTCATTCACGTTTTTGAACCCGTGGAGGACGGGCAGACTCGCGGTGCAAATGTGTTTTACAGCGTGATGGAGCAGATGAAGATGCTCGACACGCTGCAGAACACGCAGCTGCAGAGCGCCATTGTGAAGGCGATGTATGCCGCCACCATTGAGAGTGAGCTGGATACGCAGTCAGCGATGGATTTTATTCTGGGCGCGAACAGTCAGGAGCAGCGGGAAAGGCTGACCGGCTGGATTGGTGAAATTGCCGCGTATTACGCCGCAGCGCCGGTCCGGCTGGGAGGCGCAAAAGTACCGCACCTGATGCCGGGTGACTCACTGAACCTGCAGACGGCTCAGGATACGGATAACGGCTACTCCGTGTTTGAGCAGTCACTGCTGCGGTATATCGCTGCCGGGCTGGGTGTCTCGTATGAGCAGCTTTCCCGGAATTACGCCCAGATGAGCTACTCCACGGCACGGGCCAGTGCGAACGAGTCGTGGGCGTACTTTATGGGGCGGCGAAAATTCGTCGCATCCCGTCAGGCGAGCCAGATGTTTCTGTGCTGGCTGGAAGAGGCCATCGTTCGCCGCGTGGTGACGTTACCTTCAAAAGCGCGCTTCAGTTTTCAGGAAGCCCGCAGTGCCTGGGGGAACTGCGACTGGATAGGCTCCGGTCGTATGGCCATCGATGGTCTGAAAGAAGTTCAGGAAGCGGTGATGCTGATAGAAGCCGGACTGAGTACCTACGAGAAAGAGTGCGCAAAACGCGGTGACGACTATCAGGAAATTTTTGCCCAGCAGGTCCGTGAAACGATGGAGCGCCGTGCAGCCGGTCTTAAACCGCCCGCCTGGGCGGCTGCAGCATTTGAATCCGGGCTGCGACAATCAACAGAGGAGGAGAAGAGTGACAGCAGAGCTGCGTAATCTCCCGCATATTGCCAGCATGGCCTTTAATGAGCCGCTGATGCTTGAACCCGCCTATGCGCGGGTTTTCTTTTGTGCGCTTGCAGGCCAGCTTGGGATCAGCAGCCTGACGGATGCGGTGTCCGGCGACAGCCTGACTGCCCAGGAGGCACTCGCGACGCTGGCATTATCCGGTGATGATGACGGACCACGACAGGCCCGCAGTTATCAGGTCATGAACGGCATCGCCGTGCTGCCGGTGTCCGGCACGCTGGTCAGCCGGACGCGGGCGCTGCAGCCGTACTCGGGGATGACCGGTTACAACGGCATTATCGCCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGGACGGCATTCTGCTCGATATGGACACGCCCGGCGGGATGGTGGCGGGGGCATTTGACTGCGCTGACATCATCGCCCGTGTGCGTGACATAAAACCGGTATGGGCGCTTGCCAACGACATGAACTGCAGTGCAGGTCAGTTGCTTGCCAGTGCCGCCTCCCGGCGTCTGGTCACGCAGACCGCCCGGACAGGCTCCATCGGCGTCATGATGGCTCACAGTAATTACGGTGCTGCGCTGGAGAAACAGGGTGTGGAAATCACGCTGATTTACAGCGGCAGCCATA

    et merci pour vous

  2. #2
    Expert Confirmé Sénior


    Homme Profil pro
    Conseil - Consultant en systèmes d'information
    Inscrit en
    mai 2012
    Messages
    1 742
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France, Yvelines (Île de France)

    Informations professionnelles :
    Activité : Conseil - Consultant en systèmes d'information
    Secteur : High Tech - Opérateur de télécommunications

    Informations forums :
    Inscription : mai 2012
    Messages : 1 742
    Points : 4 689
    Points
    4 689
    Billets dans le blog
    1

    Par défaut

    Bonjour,

    as-tu commencé à coder quelque chose? Ce serait bien que tu le montres.
    La programmation fonctionnelle en Perl : 1. les opérateurs de liste; 2. les fonctions d'ordre supérieur; 3. étendre le langage.
    De Perl 5 à Perl 6 : 1. Les bases; 2. Les nouveautés; 3. Approfondissements

    _____
    Sauf mention contraire explicite, les bouts de code que je poste en réponse à une question n'ont pas forcément été testés.

  3. #3

    Femme Profil pro
    Étudiant
    Inscrit en
    février 2013
    Messages
    3
    Détails du profil
    Informations personnelles :
    Sexe : Femme

    Informations professionnelles :
    Activité : Étudiant
    Secteur : Santé

    Informations forums :
    Inscription : février 2013
    Messages : 3
    Points : -1
    Points
    -1

    Par défaut

    jai aucune idéé pour commencer, comment je peux trouver une solution sachant que on a pas fait un TP et en plus on a fait juste 4h de cours, c à vous d'imaginer ma situation!!!
    merci pour la reponse

  4. #4
    Membre expérimenté Avatar de LinuxUser
    Inscrit en
    avril 2007
    Messages
    846
    Détails du profil
    Informations forums :
    Inscription : avril 2007
    Messages : 846
    Points : 576
    Points
    576

    Par défaut

    Citation Envoyé par wiiiwha Voir le message
    jai aucune idéé pour commencer, comment je peux trouver une solution sachant que on a pas fait un TP et en plus on a fait juste 4h de cours, c à vous d'imaginer ma situation!!!
    Tous les élèves de ta classe sont dans la même situation , donc si le prof estime que cela est faisable c'est que ça l'est.

    Citation Envoyé par wiiiwha Voir le message
    merci pour la reponse
    Personne ne fera ton exercice à ta place.

    Commence par expliquer ce que tu n'arrives pas à faire.

  5. #5

    Femme Profil pro
    Étudiant
    Inscrit en
    février 2013
    Messages
    3
    Détails du profil
    Informations personnelles :
    Sexe : Femme

    Informations professionnelles :
    Activité : Étudiant
    Secteur : Santé

    Informations forums :
    Inscription : février 2013
    Messages : 3
    Points : -1
    Points
    -1

    Par défaut

    d'accord!!!! ce qui concerne l'origine d'une sequence???
    est ce que, pour le cas de mes 2 sequences, il faut effectuer l'inversion ou bien la complémentation pour etre sous forme FASTA???
    faux ou vrai??

  6. #6
    Membre expérimenté Avatar de LinuxUser
    Inscrit en
    avril 2007
    Messages
    846
    Détails du profil
    Informations forums :
    Inscription : avril 2007
    Messages : 846
    Points : 576
    Points
    576

    Par défaut

    On a pas à se plonger dans tes cours pour savoir ce qu'est "l'origine du séquence " ou une forme "FASTA".
    C'est à toi de formaliser ton problème informatiquement, puis ensuite si tu bloques sur un point technique on pourra t'aider.

  7. #7
    Expert Confirmé Sénior


    Homme Profil pro
    Conseil - Consultant en systèmes d'information
    Inscrit en
    mai 2012
    Messages
    1 742
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France, Yvelines (Île de France)

    Informations professionnelles :
    Activité : Conseil - Consultant en systèmes d'information
    Secteur : High Tech - Opérateur de télécommunications

    Informations forums :
    Inscription : mai 2012
    Messages : 1 742
    Points : 4 689
    Points
    4 689
    Billets dans le blog
    1

    Par défaut

    Exactement, je peux t'aider à résoudre un problème en Perl, ou plusieurs s'il y en a plusieurs, si besoin et dans la mesure de mes compétences, mais la dernière fois que j'ai fait de la biologie et de la génétique, c'était en 1975, je suis largué quand tu parles d'origine, et Orf et NCBI ne me parlent absolument pas. Tu ne me donnes aucun moyen de t'aider.
    La programmation fonctionnelle en Perl : 1. les opérateurs de liste; 2. les fonctions d'ordre supérieur; 3. étendre le langage.
    De Perl 5 à Perl 6 : 1. Les bases; 2. Les nouveautés; 3. Approfondissements

    _____
    Sauf mention contraire explicite, les bouts de code que je poste en réponse à une question n'ont pas forcément été testés.

  8. #8
    Responsable Perl et Outils

    Avatar de djibril
    Homme Profil pro
    Inscrit en
    avril 2004
    Messages
    17 686
    Détails du profil
    Informations personnelles :
    Sexe : Homme
    Localisation : France

    Informations forums :
    Inscription : avril 2004
    Messages : 17 686
    Points : 492 621
    Points
    492 621

    Par défaut

    Merci de changer le titre de cette discussion sous peine de fermeture de cette dernière.

    Pas de questions technique par messagerie privée (lisez les règles du forum Perl) et pour les nouveaux !

Discussions similaires

  1. Connection a une BD SQL SERVER Aidez Moi SVP????
    Par pop bob dans le forum Bases de données
    Réponses: 3
    Dernier message: 07/08/2005, 16h29
  2. Recuperation de ma base BD apres la sauvegarde Aidez Moi SVP
    Par pop bob dans le forum MS SQL-Server
    Réponses: 2
    Dernier message: 26/07/2005, 16h38
  3. J'ai du mal à me décider ! Aidez moi svp :)
    Par VanHelsing dans le forum Mobiles
    Réponses: 18
    Dernier message: 01/06/2005, 14h59
  4. Je vois pas d'où vient mon erreur!! Aidez moi SVP
    Par liliboms dans le forum MS SQL-Server
    Réponses: 3
    Dernier message: 04/04/2005, 08h25
  5. Réponses: 29
    Dernier message: 11/05/2004, 13h18

Partager

Partager
  • Envoyer la discussion sur Viadeo
  • Envoyer la discussion sur Twitter
  • Envoyer la discussion sur Google
  • Envoyer la discussion sur Facebook
  • Envoyer la discussion sur Digg
  • Envoyer la discussion sur Delicious
  • Envoyer la discussion sur MySpace
  • Envoyer la discussion sur Yahoo