1. #1
    Membre du Club
    Inscrit en
    janvier 2010
    Messages
    254
    Détails du profil
    Informations forums :
    Inscription : janvier 2010
    Messages : 254
    Points : 51
    Points
    51

    Par défaut Manipulation sequence fichier fasta

    Bonjour à tous,

    J'ai un problème avec la manipulation d'un fichier fasta.
    Il ressemble à cela :

    >pi1
    ATGCGTGAAATGCAT
    >pi2
    TGCCCTGATAGGGACCAGTAGAC
    >pi3
    ATGCGTGAAATGCATA
    >pi4
    TGCATGACTA
    >pi5
    ATGCGTGAAATGCATAT

    J'ai mis en gras les pi ayant la même séquence, et je souhaite garder seulement la plus longue sequence, donc mon nouveau fichier :
    >pi5
    ATGCGTGAAATGCATAT
    >pi2
    TGCCCTGATAGGGACCAGTAGAC
    >pi4
    TGCATGACTA

    Je n'ai aucune idée de comment faire ce genre de chose, quelqu'un pourrait m'aider ?

    Merci d'avance.

  2. #2
    Membre émérite
    Profil pro
    Assistant recherche bioinformatique
    Inscrit en
    novembre 2007
    Messages
    866
    Détails du profil
    Informations personnelles :
    Localisation : Canada

    Informations professionnelles :
    Activité : Assistant recherche bioinformatique

    Informations forums :
    Inscription : novembre 2007
    Messages : 866
    Points : 892
    Points
    892

    Par défaut

    Hello,
    Quelles sont les conditions exactes pour que le pi soit et ne soit pas choisi ?
    (longueur minimum en commun par exemple)
    Z.

Partager

Partager
  • Envoyer la discussion sur Viadeo
  • Envoyer la discussion sur Twitter
  • Envoyer la discussion sur Google
  • Envoyer la discussion sur Facebook
  • Envoyer la discussion sur Digg
  • Envoyer la discussion sur Delicious
  • Envoyer la discussion sur MySpace
  • Envoyer la discussion sur Yahoo