Publicité
+ Répondre à la discussion
Affichage des résultats 1 à 2 sur 2
  1. #1
    Membre du Club
    Inscrit en
    janvier 2010
    Messages
    214
    Détails du profil
    Informations forums :
    Inscription : janvier 2010
    Messages : 214
    Points : 40
    Points
    40

    Par défaut Manipulation sequence fichier fasta

    Bonjour à tous,

    J'ai un problème avec la manipulation d'un fichier fasta.
    Il ressemble à cela :

    >pi1
    ATGCGTGAAATGCAT
    >pi2
    TGCCCTGATAGGGACCAGTAGAC
    >pi3
    ATGCGTGAAATGCATA
    >pi4
    TGCATGACTA
    >pi5
    ATGCGTGAAATGCATAT

    J'ai mis en gras les pi ayant la même séquence, et je souhaite garder seulement la plus longue sequence, donc mon nouveau fichier :
    >pi5
    ATGCGTGAAATGCATAT
    >pi2
    TGCCCTGATAGGGACCAGTAGAC
    >pi4
    TGCATGACTA

    Je n'ai aucune idée de comment faire ce genre de chose, quelqu'un pourrait m'aider ?

    Merci d'avance.

  2. #2
    Membre émérite
    Profil pro
    Assistant recherche bioinformatique
    Inscrit en
    novembre 2007
    Messages
    859
    Détails du profil
    Informations personnelles :
    Localisation : Canada

    Informations professionnelles :
    Activité : Assistant recherche bioinformatique

    Informations forums :
    Inscription : novembre 2007
    Messages : 859
    Points : 890
    Points
    890

    Par défaut

    Hello,
    Quelles sont les conditions exactes pour que le pi soit et ne soit pas choisi ?
    (longueur minimum en commun par exemple)
    Z.

Liens sociaux

Règles de messages

  • Vous ne pouvez pas créer de nouvelles discussions
  • Vous ne pouvez pas envoyer des réponses
  • Vous ne pouvez pas envoyer des pièces jointes
  • Vous ne pouvez pas modifier vos messages
  •